python, R) to map multiple short sequences to a reference sequence, which has the capability to annotate all possible alignment sites on the reference sequence?Įdit the ideal output would be a fasta sequence with the all possible alignments of the TF sequences mapped and onto my reference DNA. I was just wondering if there are any suggestions or platforms (E.g. However, when I manually ctrl+f to search for matches for my TF sequence, there are two sites (bold above) which match my sequence 100%, however it can only be automatically aligned or made into a feature by snapgene for the first matching site it comes across and does not do it for the second site. SnapGene Viewer is highlighted here due to its user-friendly interface and cross-platform. Click the right 'Jump' triangle in the bottom panel to jump to the first mismatch or gap discrepancy in the alignment. Multiple software options are available for DNA sequence analysis. The bottom panel 2 shows the CAP3 consensus (Original Sequence) and the aligned trace sequences within the field of view. When I try to use the alignment function in snapgene, the output shows one site where the TF sequence is mapped to. The top panel 1 shows the initial CAP3 consensus (Original Sequence). GAGGGATTCTGCCAGCAAAGCAGACGAGGGGATGTGCTGAGTCTCACAGACACTTTCCTGGATAAGACATGAATGCAGGC ATGTCAGGAAGAGCAAGCAAACACGCTGTCC ![]() I am trying to align hundreds of transcription factor binding site sequences to my reference sequence.įor example in the sequence below, in bold are the two TF binding sites it maps to.ĬTGGCGCGTGATCAACTGGCCAATCATGGCATCTGTCATTGTGAGTATAACCTCACACCCGTACTTCTAAACACACAGACCAGCCTCATACTGTATGCATT ATGTCAGGCAGG
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |